Contaminating DNA. Briefly, g total RNA was treated with TURBO DNase for min at . Digestion was stopped by addition of DNase inactivation reagent, for min at area temperature. The samples had been centrifuged, as well as the supernatant containing RNA was recovered. For firststrand synthesis of cDNA from RNA molecules, g RNA was incubated with oligodT primer for min at , and dNTPs and MMLVRT had been added. The mixture was incubated for min at and for min at .rna isolation, Dnase Therapy, and cDna synthesisgene expression evaluation by Quantitative realtime PcrQuantitative realtime PCR was performed using genespecific primers designed utilizing Primer Express (Applied Biosystems). The primers are shown in Table . Quantitative RTPCR (qRTPCR) analyses have been set up using . L cDNA, L of SYBR reen PCR Master Mix (Life Technologies) L of every forward and reverse primer (nM) L of uracilNglycosylase (Applied Biosystems), and . L of injectable water, totalizing a final volume of L. Reactions 
had been run inside a Quickly RealTime PCRFrontiers in Immunology MarchMendozaCoronel and OrtegaModulation of Phagocytosis in Polarized MacrophagesTable Primers pairs made use of for determination of gene expression by qrTPcr. gene HPRT specific primers pair ForwardTTATGGACAGGACTGAACGTCTTG ReverseCCAGCAGGTCAGCAAAGAATT bp CBR-5884 chemical information Hematoporphyrin (dihydrochloride) Productbp FCGR ForwardGGGCAAGTGGACACCACAA ReverseTGCAAGGTTACGGTTTCCTCTT Productbp FCGRA ForwardGGCTTCTGCAGACAGTCAAGC ReverseCCTGGAGCACGTTGATCCAC Productbp FCGRB ForwardGCAGTTCCAAAAGAGAAGGTTTCT ReverseTCGGTTATTTGGGACCATATTGT Productbp FCGRA ForwardGGTGCAGCTAGAAGTCCATATCG ReverseGAATAGGGTCTTCCTCCTTGAACA Productbp exon Phagocytosis through Fcri, Fcrii, or cD (selective Phagocytosis)Sheep red blood cells (SRBCs) have been maintained in Alsever’s answer until applied. Modified SRBCs had been prepared as described previously . In short, erythrocytes (at . mL in PBSBSA .) had been stained with mM CFSE. The stained SRBCs had been incubated with gmL SulfoNHSbiotin for min at . Soon after washing, they were coated with gmL streptavidin for min at . The biotinstreptavidincoated erythrocytes were washed and incubated with biotinylated F(ab) fragments of goat antimouse IgG for min. SRBCs labeled with CFSE and coated with biotin, streptavidin, and fragments of biotinylated antiIgG antibodies are henceforth designated EBSFab. For phagocytosis assays, hMDMs had been incubated with g of Fab fragments of mAb (antihuman CD), or g Fab fragments of mAb. (antihuman FcRI), or g Fab fragments of mAbIV. (antihuman FcRII), or g IgG (isotypematched handle), or without therapy (handle) for 
min at , washed, and incubated with EBSFab at a ratio of monocytic cellEBSFab, at for min. Equivalent samples had been incubated at as adverse controls of phagocytosis. Noninternalized erythrocytes had been lysed by hypotonic shock. Phagocytosis was quantified by flow cytometry (Attune acoustic focusing flow cytometer; Applied Biosystems, Foster City, CA, USA), with addition of Trypan blue . in PBS (pH .), to quench extracellular fluorescence from attached but not internalized erythrocytes. Information are PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/18065174 expressed as the percentage of CFSEpositive cells (i.e cells which have ingested at the very least one particular erythrocyte) and as phagocytic index (PI), calculated making use of the following formulaPI (CFSEpositive cells) (MFI of cells containing erythrocytes). Benefits had been analyzed working with AttuneCytometric Application version . compatible with each Blue Violet and BlueRed configurations.system (Applied Biosystems) below the following situations for min, for m.Contaminating DNA. Briefly, g total RNA was treated with TURBO DNase for min at . Digestion was stopped by addition of DNase inactivation reagent, for min at area temperature. The samples had been centrifuged, plus the supernatant containing RNA was recovered. For firststrand synthesis of cDNA from RNA molecules, g RNA was incubated with oligodT primer for min at , and dNTPs and MMLVRT have been added. The mixture was incubated for min at and for min at .rna isolation, Dnase Therapy, and cDna synthesisgene expression evaluation by Quantitative realtime PcrQuantitative realtime PCR was performed applying genespecific primers created employing Primer Express (Applied Biosystems). The primers are shown in Table . Quantitative RTPCR (qRTPCR) analyses had been set up applying . L cDNA, L of SYBR reen PCR Master Mix (Life Technologies) L of each forward and reverse primer (nM) L of uracilNglycosylase (Applied Biosystems), and . L of injectable water, totalizing a final volume of L. Reactions were run within a Quick RealTime PCRFrontiers in Immunology MarchMendozaCoronel and OrtegaModulation of Phagocytosis in Polarized MacrophagesTable Primers pairs made use of for determination of gene expression by qrTPcr. gene HPRT particular primers pair ForwardTTATGGACAGGACTGAACGTCTTG ReverseCCAGCAGGTCAGCAAAGAATT bp Productbp FCGR ForwardGGGCAAGTGGACACCACAA ReverseTGCAAGGTTACGGTTTCCTCTT Productbp FCGRA ForwardGGCTTCTGCAGACAGTCAAGC ReverseCCTGGAGCACGTTGATCCAC Productbp FCGRB ForwardGCAGTTCCAAAAGAGAAGGTTTCT ReverseTCGGTTATTTGGGACCATATTGT Productbp FCGRA ForwardGGTGCAGCTAGAAGTCCATATCG ReverseGAATAGGGTCTTCCTCCTTGAACA Productbp exon Phagocytosis by means of Fcri, Fcrii, or cD (selective Phagocytosis)Sheep red blood cells (SRBCs) have been maintained in Alsever’s resolution till employed. Modified SRBCs have been ready as described previously . In brief, erythrocytes (at . mL in PBSBSA .) have been stained with mM CFSE. The stained SRBCs were incubated with gmL SulfoNHSbiotin for min at . Following washing, they were coated with gmL streptavidin for min at . The biotinstreptavidincoated erythrocytes had been washed and incubated with biotinylated F(ab) fragments of goat antimouse IgG for min. SRBCs labeled with CFSE and coated with biotin, streptavidin, and fragments of biotinylated antiIgG antibodies are henceforth designated EBSFab. For phagocytosis assays, hMDMs have been incubated with g of Fab fragments of mAb (antihuman CD), or g Fab fragments of mAb. (antihuman FcRI), or g Fab fragments of mAbIV. (antihuman FcRII), or g IgG (isotypematched handle), or without treatment (manage) for min at , washed, and incubated with EBSFab at a ratio of monocytic cellEBSFab, at for min. Equivalent samples have been incubated at as unfavorable controls of phagocytosis. Noninternalized erythrocytes were lysed by hypotonic shock. Phagocytosis was quantified by flow cytometry (Attune acoustic focusing flow cytometer; Applied Biosystems, Foster City, CA, USA), with addition of Trypan blue . in PBS (pH .), to quench extracellular fluorescence from attached but not internalized erythrocytes. Data are PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/18065174 expressed because the percentage of CFSEpositive cells (i.e cells that have ingested at the very least a single erythrocyte) and as phagocytic index (PI), calculated making use of the following formulaPI (CFSEpositive cells) (MFI of cells containing erythrocytes). Benefits have been analyzed applying AttuneCytometric Application version . compatible with each Blue Violet and BlueRed configurations.program (Applied Biosystems) below the following situations for min, for m.